RegulonDB RegulonDB 10.9: Gene Sequence
baeS gene sequence


Size: 1404        A: 321  T: 329  G: 389  C: 365

Fasta

 

>baeS E. coli K12. Version NC_000913.3 GI:556503834
atgaagttctggcgacccggtattaccggcaaactgtttctggcgattttcgccacctgc
attgtcttgctgatcagtatgcactgggcggtgcgtatcagttttgagcgtggctttatt
gattacatcaagcatggtaatgaacagcgattacaactgttaagtgatgcgcttggcgag
cagtatgcgcagcatggcaactggcgcttcctgcgcaacaatgatcgctttgtctttcag
atcctgcgttcatttgaacacgataattcggaagataaacccggcccgggtatgccaccg
cacggctggcgtacccagttctgggtggttgatcaaaacaacaaagtgctggttggtccg
cgagcgccgattccacctgacggtacacggcgacccattctggtcaacggtgcggaagtt
ggcgcggtgatcgcctcccccgttgagcggttaacgcgcaatactgatatcaatttcgat
aaacaacagcggcaaaccagctggttgattgtcgccctggcaacgttactcgcggcactt
gccacttttctgctggcgcgcggtttactggcaccggtaaaacgacttgtcgatggcacg
cacaaactggcggcgggcgatttcactacccgcgtaacgcccaccagtgaagatgaactg
ggcaaactggcgcaagacttcaaccagcttgccagcacactggagaaaaaccagcaaatg
cggcgcgattttatggccgatatttctcacgaactgcgtacgccattagcggtgctgcgc
ggtgaactggaagccattcaggatggcgtgcgtaaattcacgccggagacggtggcgtct
ttacaggcggaggtcggtacactgaccaaactggttgacgatctccatcagttgtcgatg
tctgatgaaggcgctctcgcctatcaaaaagcaccggtagatttgatcccactgctggaa
gtggcgggcggcgcatttcgcgaacgattcgccagtcgtggcctgaaactgcaattttcc
ctgccagacagtattaccgtatttggcgatcgcgaccgtttaatgcagttattcaataac
ttactggaaaacagcctgcgctacactgacagcggcggcagcctgcaaatctctgccggg
cagcgcgacaaaacggtgcgcctgacctttgccgacagtgcgccaggtgtcagtgacgat
cagctacaaaaattgtttgaacgtttttatcgcaccgaaggttcccgcaaccgtgccagc
ggcggttccgggctggggctggcgatttgcctgaacattgttgaagcacataatggtcgc
attattgctgcccattcgccttttggcggggtaagcattacagtagagttaccgctggaa
cgggatttacagagagaagtatga
              
                            

Download fasta file
RegulonDB