RegulonDB RegulonDB 10.10: Gene Sequence
baeR gene sequence


Size: 723        A: 168  T: 164  G: 194  C: 197

Fasta

 

>baeR E. coli K12. Version NC_000913.3 GI:556503834
atgaccgagttaccaatcgacgaaaacacaccgcgtattttgatcgtggaagatgaaccg
aagctggggcagttgctcattgattatctgcgtgctgcgagctatgcgccgacgcttatc
agccacggcgatcaggtactgccgtatgtgcgccagacaccaccggatctgatcctgtta
gatctgatgctccctggcaccgatggcctgacgctgtgccgggaaattcgtcgtttttct
gacattccgatcgtgatggtgacggcaaaaatcgaagagatcgatcgcctgctggggctg
gagattggcgcagatgattatatctgtaagccgtacagcccacgggaagtggtagcgcgc
gtcaaaaccattttgcgccgttgcaaaccgcagcgcgagttgcagcaacaggatgctgaa
agcccgttgattatcgacgaaggtcgttttcaggcttcatggcgcggtaaaatgcttgac
ctgacgcctgcggaatttcgtctgctgaaaacgctctctcacgaaccaggaaaagtgttc
tcccgcgagcaattgctcaatcatctttatgacgactaccgcgtagtaaccgaccgcacc
atcgacagccacattaaaaacctgcgccgcaagctggaatctctcgacgccgaacagtca
tttatccgcgccgtttatggcgtcggttaccgctgggaagccgacgcctgccgcatcgtt
tag
              
                            

Download fasta file
RegulonDB