RegulonDB RegulonDB 10.9: Gene Sequence
metN gene sequence


Size: 1032        A: 250  T: 236  G: 280  C: 266

Fasta

 

>metN E. coli K12. Version NC_000913.3 GI:556503834
atgataaaactttcgaatatcaccaaagtgttccaccagggcacccgcaccatccaggcg
ttgaacaacgtcagcctgcatgtgccagctggacaaatttatggcgttatcggtgcctca
ggcgcgggtaagagtacgcttatacgttgtgtaaacctgctggagcgcccaaccgagggt
agcgtgctggtcgatggccaggaactgaccacgctgtcagaatccgagttgaccaaagct
cgccgccagattggtatgattttccagcattttaacctgctctcttcgcgtactgttttt
ggcaacgtggctctgccgctggagctggacaacacaccgaaagacgaggtcaaacgtcgc
gtgacggaattgctgtcattggttggtcttggcgataagcatgatagctacccgtcgaat
ctttccggtgggcagaaacaacgtgtggcaattgcccgtgcgttagccagcaatcccaaa
gtattgctgtgtgatgaagccaccagcgcgctggacccggcaacgacacgttctattctc
gaactgctgaaagacatcaaccgccgtctggggttgacgattctgttgatcacccacgaa
atggacgttgtgaagcgcatttgtgattgcgtggcggtcatcagcaatggagaactgatc
gagcaggacacggtaagtgaagtgttctcgcatccgaaaacgccgctggcgcagaagttt
attcagtcgaccctgcatctggatatcccggaagattaccaggaacgtctgcaagcggag
ccatttactgactgcgtgccgatgctgcgtctggagtttaccggtcaatcggtcgatgcc
ccactgctttctgaaaccgcgcgtcgtttcaacgtcaacaacaacattattagcgcgcag
atggattacgccggtggcgttaagttcggcatcatgctgactgaaatgcacggcacacaa
caagatacgcaagccgccattgcctggctgcaggaacaccatgtaaaagtagaggtactg
ggttatgtctga
              
                            

Download fasta file
RegulonDB