RegulonDB RegulonDB 10.9: Gene Sequence
mdlB gene sequence


Size: 1782        A: 358  T: 421  G: 552  C: 451

Fasta

 

>mdlB E. coli K12. Version NC_000913.3 GI:556503834
atgcgtagttttagccaactgtggccgactctcaagcgcctgttagcgtacggttcgccg
tggcgtaaaccgctggggattgcggtcctgatgatgtgggttgcggcggcggcagaagtc
agtgggccgctgcttatcagctattttatcgacaatatggtagcgaaaaataacctgccg
ttgaaagtggttgcagggctggctgcggcgtatgttgggctgcaactgtttgccgccggg
ctacattacgcgcagtcgctgctgtttaatcgggcggcagtaggcgtagtgcaacagttg
cgtaccgacgtgatggatgctgcgttacgccagccattaagcgagtttgatacccaaccc
gtcgggcaggtgatttcccgcgtcactaatgacactgaagtgatccgcgatctctacgtt
accgtagtggcaactgtcctgcgcagtgccgcgctggtgggcgcgatgctggtggcgatg
ttcagcctcgactggcgaatggcactggtggcgataatgattttcccggtggtgctggtg
gtaatggtgatataccagcgttacagcacgccgattgtccgtcgtgtgcgcgcctatttg
gcggatatcaacgacggctttaacgaaatcatcaatggcatgagcgttatccagcagttt
cgtcagcaggcgcgatttggcgaacgtatgggggaggccagtcgttcacactatatggcg
aggatgcaaaccctgcgcctcgacggttttctgctgcgtccgctgctgagtctgttttca
tcgctcattctttgtggcttgttgatgctgtttggcttctccgccagcggcaccattgaa
gtgggcgtgctgtatgcgtttatcagctatcttgggcgacttaacgaaccattaatcgaa
ctgaccacgcaacaggcgatgctgcaacaggctgttgttgctggtgagcgcgtgtttgaa
ctgatggacggaccgcgccagcaatatggcaatgatgatcgcccgttacagagtggcacc
atcgaagtcgataacgtgtcatttgcttatcgcgatgacaatctggtgctaaagaacatt
aatctctctgtgccttcgcgcaattttgtggcgctggtcgggcataccggcagtggcaaa
agcaccctcgccagtttattgatgggctattacccgctaacggaaggtgagattcgcctt
gatggtcgtccattaagttcgctaagtcacagcgcgctgcgccagggcgtggcaatggtg
cagcaagatccggtggtgctggcggataccttcctcgccaacgtgacgctggggcgggat
atctccgaagaacgcgtctggcaggcgctggaaaccgtgcaactggcggagctggcgcgt
agcatgagcgacggtatttacacgccgctgggcgagcaggggaataatctctcagttggg
caaaagcaactgctggcactggcgcgcgtgctggtcgagacgccgcaaatcctgatcctt
gatgaggcaaccgccagcattgactccggtactgaacaggcgattcaacatgctctggcg
gcggtgcgtgaacataccacgctggtagtgattgctcaccgcttatcgaccattgttgat
gccgacaccattctggtgcttcatcgtgggcaagccgtggagcagggcactcaccagcaa
ctgctggcggcccagggacgctactggcagatgtatcaactgcaacttgcgggcgaagag
ctggcagccagcgtgcgtgaagaggaatcattgagcgcctga
              
                            

Download fasta file
RegulonDB