RegulonDB RegulonDB 10.9: Gene Sequence
sdaB gene sequence


Size: 1368        A: 310  T: 306  G: 397  C: 355

Fasta

 

>sdaB E. coli K12. Version NC_000913.3 GI:556503834
atgattagcgtattcgatattttcaaaatcggcattggcccttccagttctcataccgtt
ggaccaatgaaagcgggtaaacaatttaccgacgatctgattgcccgtaacctgcttaaa
gacgtgacccgcgtggtggttgacgtgtacggctcgctctctctgaccggtaaaggccac
cacactgatatcgccattattatgggcctggcgggtaacctgccggataccgtggatatc
gattccatccccagttttattcaggatgtgaatactcatggtcgcctgatgctggcaaac
ggtcagcatgaagtggagttcccggttgatcagtgcatgaacttccacgccgacaacctt
tctctgcatgaaaacggtatgcgcattaccgcgctggcgggcgataaagtcgtttacagc
cagacttactactctattggcggtggctttatcgttgatgaagagcattttggccagcag
gatagcgcaccggttgaagttccttatccgtacagttcagcagccgatctgcaaaaacat
tgtcaggaaaccgggctgtcactctctggcctgatgatgaaaaacgagctggcgctgcac
agcaaagaagagctggaacagcacctggcgaacgtctgggaagtcatgcgcggcggtatt
gagcgcggtatttccaccgaaggcgtgttgcctggcaaactgcgcgttccacgccgtgct
gcggcactacgccggatgctggtcagccaggataaaaccaccactgacccgatggcggtt
gttgactggatcaacatgtttgcactggcagtgaacgaagagaacgctgctggcggtcgc
gtggtgactgcgccgactaacggtgcgtgcgggattatcccggcagttctggcgtactac
gacaagtttatccgcgaagtgaacgctaactcactggctcgttacctgctggtagccagc
gccattggttctctttataagatgaacgcgtcgatttctggtgctgaagtgggttgccag
ggtgaagttggcgtggcgtgctcaatggcggcggctggtctggcagaactattaggcgca
agcccggcgcaggtgtgcatcgcggcggaaatcgccatggagcacaacctcggtctgacg
tgtgacccggtcgccggacaggtacaggtgccatgcatcgagcgtaacgccattgcggca
gtaaaagcggtgaacgccgcacgtatggcgctgcgccgtaccagcgagccgcgcgtctgc
ctcgataaagttatcgaaaccatgtacgaaacaggtaaagatatgaacgccaagtaccgc
gaaacctctcgcggcggcctggcaatgaagatcgttgcctgcgattaa
              
                            

Download fasta file
RegulonDB