RegulonDB RegulonDB 10.10: Gene Sequence
artP gene sequence


Size: 729        A: 179  T: 166  G: 190  C: 194

Fasta

 

>artP E. coli K12. Version NC_000913.3 GI:556503834
atgagtattcaattaaacggcattaattgcttctacggcgcgcatcaggcgctgttcgat
atcacgctggattgcccacagggcgaaacgctggtgttacttggccccagcggcgcgggt
aaaagctcgctgctgcgtgtactcaatctgcttgagatgccgcgctccggtacgctcaac
attgcaggcaaccatttcgatttcaccaaaacaccctctgacaaagcgattcgcgatttg
cgtcgtaacgttggcatggtgtttcagcaatacaacctgtggccgcatctgaccgtgcag
caaaacctgattgaagcgccctgccgtgtactggggttgagtaaagatcaggcgctggcc
cgtgcagaaaaactgctggaacgtctgcgtctcaaaccttatagcgatcgttacccgctg
catctttctggtggtcagcagcagcgtgttgctattgcccgtgcgttgatgatggaaccg
caggtactgctgttcgatgaaccgaccgccgcactggacccggaaattacggcacaaatc
gtcagcatcattcgtgagctggcagaaacgaatattacccaggtgatcgtcacccacgaa
gttgaagtggcgcgtaaaaccgccagccgagtggtgtatatggaaaatggtcatatcgta
gaacaaggcgacgcgagctgctttaccgagccgcaaaccgaagcatttaaaaactatctc
tctcactaa
              
                            

Download fasta file
RegulonDB