RegulonDB RegulonDB 10.8: Gene Sequence
artQ gene sequence


Size: 717        A: 124  T: 199  G: 215  C: 179

Fasta

 

>artQ E. coli K12. Version NC_000913.3 GI:556503834
atgaatgaattttttcctttagcaagcgccgccgggatgaccgtcggccttgccgtttgt
gcattgattgtcgggctggcgctggcgatgttctttgcggtatgggagtcggcaaaatgg
cgtcctgtcgcgtgggcaggttcagcgctggtaaccattctgcgtggcctgccagaaatt
ctggtggtgctgtttatctattttggctcctcgcagctgctgctgacgctttcggatggc
ttcactatcaatcttgggttcgtgcagatcccagtgcagatggacattgagaacttcgac
gttagcccgttcctttgtggtgtcatcgctctgtcactgctgtatgccgcctatgcctcg
caaacgcttcggggcgcgttgaaagcggtgccggtgggtcagtgggagtctggtcaggcg
ctggggctgtcgaaatcggctatctttttccgtctggtgatgccgcagatgtggcgtcat
gcgctgcctggcctcggtaaccagtggctggtgctgctgaaagataccgcgctggtcagt
ttgattagtgtgaatgatttaatgctgcaaacaaaaagcatcgctactcgtacccaggaa
ccatttacctggtacattgtggcggcggcgatttacctggtgatcaccctgctcagtcag
tacattctcaaacgcattgacctgcgcgcgacacgttttgagcggaggcccagctaa
              
                            

Download fasta file
RegulonDB