RegulonDB RegulonDB 11.0: Gene Sequence
artM gene sequence


Size: 669        A: 137  T: 183  G: 190  C: 159

Fasta

 

>artM E. coli K12. Version NC_000913.3 GI:556503834
atgtttgagtatttacccgaactgatgaaagggctacacaccagcctgacgctaaccgtt
gcctcgctgattgtggcactgattctggcattgatttttaccatcatcctgacgctgaaa
acgccggtgctggtgtggctggtgcggggttatatcacgctgtttaccggtacgccgctg
ctggtgcagatcttcctgatttattacgggccgggccagtttccgactttgcaggagtat
ccggcactgtggcatttgttgtcagaaccgtggttatgtgcgctgattgcgttgtcgctg
aatagtgcggcgtataccacgcagctgttttacggtgcaattcgtgcgatcccggaaggt
cagtggcagtcctgtagcgccctgggaatgagcaaaaaagatacgctggcgatcctgctg
ccgtatgcctttaaacgctcgctctcttcttattccaacgaagtggtgctggtattcaaa
agtacctctctggcatacaccattacgctgatggaagtgatgggatacagccagttgttg
tacggacgcacctacgatgtaatggtgttcggtgcggcagggattatttacctggtcgtt
aacggcctgctgacgctgatgatgcgtctgatcgagcgcaaagcgctggcattcgaacgg
cgaaattaa
              
                            

Download fasta file
RegulonDB