RegulonDB RegulonDB 10.9: Gene Sequence
potF gene sequence


Size: 1113        A: 291  T: 256  G: 296  C: 270

Fasta

 

>potF E. coli K12. Version NC_000913.3 GI:556503834
atgaccgccttaaataaaaaatggctatcgggtctggttgcgggtgctctgatggccgtc
tctgtcggcacgctcgcggctgaacaaaaaacactccacatttataactggtctgattat
atcgccccggacacggtggccaattttgaaaaagaaaccggtattaaagtcgtctacgat
gttttcgactctaacgaagtactggaaggcaaattaatggccgggagtaccggctttgat
ctggtggttccatctgccagctttctggagcgccagttgactgcgggagttttccagccg
ctggacaaaagcaaattgccggagtggaagaatctcgacccggaactgctgaagctggtc
gccaaacacgatcccgacaataaatttgctatgccctatatgtgggcgacgaccgggatt
ggctataacgttgataaagttaaagcggtgctgggcgaaaacgcgcccgtcgatagctgg
gacttgatcctcaaacctgaaaatctggaaaaactgaaaagctgcggtgtctctttcctg
gatgcgccagaagaagtttttgctaccgtgttgaattatctcggcaaagatcccaacagc
actaaagcggatgattacaccggaccggcaacagatctgctgttaaagctgcgcccgaac
attcgttatttccattcatctcaatacattaacgacctggcaaacggcgatatttgcgtc
gctatcggctgggcaggtgatgtctggcaggcgtcaaaccgcgcgaaggaagcgaagaat
ggcgtgaatgtctcgttctcgattccaaaagaaggggcgatggcgttctttgatgtattc
gccatgcctgcggatgccaaaaacaaagacgaagcctatcagttcctgaattacctgctg
cgcccggatgtagtagcgcatatttccgaccatgtgttctatgccaacgccaataaagca
gccacgccgctggtgagtgcggaagtccgtgagaacccaggtatttatccgcctgcggat
gttcgtgcgaagctgttcactctgaaagtgcaggatccgaaaatcgaccgtgtgcgcacc
cgcgcgtggaccaaagtgaagagcggaaaataa
              
                            

Download fasta file
RegulonDB