RegulonDB RegulonDB 10.9: Gene Sequence
potH gene sequence


Size: 954        A: 193  T: 275  G: 260  C: 226

Fasta

 

>potH E. coli K12. Version NC_000913.3 GI:556503834
atgagtacacttgaacctgctgcccagtcgaaaccgccgggcggatttaagctgtggttg
tcgcagctgcaaatgaagcatgggcgcaaactggtcattgcgttgccatatatctggttg
atcttgctgtttctgctgccatttctgattgtctttaaaataagcctggcggagatggcg
cgcgctattccaccttataccgaactgatggagtgggctgacgggcaactgtccatcact
cttaatctcggtaattttctgcaactgaccgacgatccgctctatttcgatgcttatctc
cagtcgctacaggtggctgcgatttcgacattttgctgtttactgatcggctatccgctg
gcgtgggcggtggcgcacagtaagccttcgacccgtaatattttattactactggtgatc
ctgccgtcgtggacctcgtttctgatccgcgtttatgcctggatgggaatattaaaaaac
aacggtgtgctgaataattttctgctgtggctgggggttatcgatcaaccgctgaccatt
ctgcataccaatctggccgtttatatcggcattgtttacgcttacgtgccgtttatggta
ctgccgatttataccgcgttgattcgtattgattattcgctggtggaagcagcgctggat
ctcggtgcacgaccgctgaaaacgttctttactgtgatcgtgccgctgactaaaggtggg
attattgccggatcgatgctggtgtttatcccggctgtgggcgagtttgtgatcccggaa
ctgctcggtggcccggacagcatcatgatcgggcgcgtgctatggcaagagtttttcaat
aaccgcgactggccggtggcctcggcggtagcgatcatcatgttgctgctgctaattgtg
ccgataatgtggttccacaaacaccagcaaaaaagcgtgggagaacacggatga
              
                            

Download fasta file
RegulonDB