RegulonDB RegulonDB 10.9: Gene Sequence
nohA gene sequence


Size: 570        A: 152  T: 112  G: 174  C: 132

Fasta

 

>nohA E. coli K12. Version NC_000913.3 GI:556503834
atggaagtcaacaaaaagcagctggctgacattttcggtgcgagtatccgtaccattcag
aactggcaggaacagggaatgcccgttctgcgaggcggtggcaagggtaatgaggtgctt
tatgactctgccgccgttataagatggtatgccgaaagggatgctgaaattgagaacgaa
aagctgcgccgggaagttgaagaactgcggcaggccagcgagacagatctccagccaggg
actattgagtacgaacgccatcgacttacgcgtgcgcaggccgacgcacaggagctgaaa
aatgccagagactccgctgaagtggtggaaaccgcattctgtactttcgtgctgtcgcgg
atcgcaggtgaaattgccagtattctcgacgggatccccctgtcggtgcagcggcgtttt
ccggaactggaaaaccgacatgttgatttcctgaaacgggatatcatcaaagccatgaac
aaagcagccgcgctggatgaactgataccggggttgctgagtgaatataaccgcgctgac
agacaatacgcagggggcagcaggtcttga
              
                            

Download fasta file
RegulonDB