RegulonDB RegulonDB 10.9: Gene Sequence
nohD gene sequence


Size: 546        A: 147  T: 112  G: 163  C: 124

Fasta

 

>nohD E. coli K12. Version NC_000913.3 GI:556503834
atggaagtcaacaaaaagcagctggctgacattttcggtgcgagtatccgtaccattcag
aactggcaggaacagggaatgcccgttctgcgaggcggtggcaagggtaatgaggtgctt
tatgactctgccgccgtcataaaatggtatgccgaaagggatgctgaaattgagaacgaa
aagctgcgccgggaggttgaagaactgctgcaggccagcgagacagatctccagccaggg
actattgagtacgaacgccatcgacttacgcgtgcgcaggccgatgcacaggagctgaaa
aatgccagagactccgctgaagtggtggaaaccgcattctgtactttcgtgctgtcgcgg
atcgcaggtgaaattgccagtattctcgacgggatccccctgtcggtgcagcggcgtttt
ccggaactggaaaaccgacatgttgatttcctgaaacgggatatcatcaaagccatgaac
aaagcagccgcgctggatgaactgataccggggttgctgagtgaatatatcgaacagtca
ggttaa
              
                            

Download fasta file
RegulonDB