RegulonDB RegulonDB 10.10: Gene Sequence
marC gene sequence


Size: 666        A: 139  T: 187  G: 193  C: 147

Fasta

 

>marC E. coli K12. Version NC_000913.3 GI:556503834
atgttagatttgtttaaagcaattggcctggggctggtggtgttgctgccgttagctaac
ccattaacaactgtcgcgttatttcttggcctggcaggcaacatgaacagtgccgaacgt
aatcgtcagtcgttgatggcctcggtgtacgtatttgccatcatgatggtggcgtattac
gccgggcaactggtgatggatacatttggcatttcgattcccggtctgcgaattgcaggc
ggcttaatcgtcgcgtttatcggttttcggatgctctttccgcaacagaaagcgattgat
tcaccggaggcgaaaagcaagtcggaagagctggaagatgaacccagtgccaatattgcc
tttgtgccgctggcaatgccaagtactgccggtccgggaaccatagcgatgattattagc
tcggcgtccacagtgcgtcagagttcaaccttcgctgattgggtactgatggttgcgccg
ccgctgatctttttcctggtggcggttattttgtggggaagcctacgcagctccggcgca
attatgcggctggtgggcaagggtggcattgaagcgatctcccgtctgatgggattcctg
ctggtatgtatgggtgtgcagtttattattaacggcatcctggaaatcattaaaacgtac
cattaa
              
                            

Download fasta file
RegulonDB