RegulonDB RegulonDB 10.9: Gene Sequence
ydeI gene sequence


Size: 393        A: 107  T: 99  G: 102  C: 85

Fasta

 

>ydeI E. coli K12. Version NC_000913.3 GI:556503834
atgaaatttcaggccattgtattagcaagttttcttgtcatgccttatgcgttggcagat
gaccagggcggtttaaaacaggatgcagcgccaccgccgcctcatgcaatagaagatggc
tatcgcggaaccgatgatgcaaaaaaaatgaccgttgatttcgcaaaaaccatgcacgat
ggcgcttcggtttcactacgcggtaatttgatttctcacaaaggagaggaccgttacgtt
tttcgcgataagagcggtgaaattaatgtcgttattcctgcggccgtctttgatggacga
gaagttcagccggaccagatgatcaacattagtggcagtctggataagaaaagcgcgccg
gccgtcgttcgggtcactcatttgcagaaataa
              
                            

Download fasta file
RegulonDB