RegulonDB RegulonDB 10.9: Gene Sequence
psuK gene sequence


Size: 942        A: 253  T: 246  G: 248  C: 195

Fasta

 

>psuK E. coli K12. Version NC_000913.3 GI:556503834
atgcgcgaaaaggattatgtcgtaattataggttcggcgaatattgatgtcgccggatat
tcacatgaatcattaaattatgcggattcaaatccaggtaaaataaaatttacgcctggt
ggagtagggcgcaatattgcacaaaacctggcgttgctgggtaacaaagcctggctactg
agcgccgtaggcagtgatttttatggtcaatcgctgctaacgcaaaccaatcaatctggc
gtttatgtcgataaatgcctgattgtgccgggagaaaatacgtcgagttatttatcatta
ctcgataataccggtgaaatgctggttgctataaatgacatgaatattagcaacgctatt
acagctgaatatctcgcacagcacggtgaatttattcagagggcaaaggtcattgtcgcg
gactgtaatatcagtgaagaggcactggcatggattctggataatgccgccaacgtaccc
gtatttgtcgatccggtttcggcatggaaatgtgtcaaagtgcgcgaccgtctaaatcag
atccacactctcaagccaaaccgccttgaagcggaaaccctgagtgggattgcgctgtca
gggcgtgaagatgtggcaaaagttgctgcctggttccatcaacatggcctgaaccgactg
gtattgagcatgggcggcgacggcgtttattacagcgatatcagcggtgaaagtggctgg
tctgcgccgatcaaaaccaatgttattaatgttaccggagcgggcgatgccatgatggcg
ggacttgcttcgtgttgggtagacggaatgccgtttgccgaatctgttcgtttcgcacag
ggatgttcgtcaatggcgctctcctgtgaatacaccaataaccccgatttatcgattgcc
aacgttatatcgttagtggagaacgcagaatgtctgaattaa
              
                            

Download fasta file
RegulonDB