RegulonDB RegulonDB 10.9: Gene Sequence
dkgB gene sequence


Size: 804        A: 231  T: 201  G: 191  C: 181

Fasta

 

>dkgB E. coli K12. Version NC_000913.3 GI:556503834
atggctatccctgcatttggtttaggtactttccgtctgaaagacgacgttgttatttca
tctgtgataacggcgcttgaacttggttatcgcgcaattgataccgcacaaatctatgat
aacgaagccgcagtaggtcaggcgattgcagaaagtggcgtgccacgtcatgaactctac
atcaccactaaaatctggattgaaaatctcagcaaagacaaattgatcccaagtctgaaa
gagagcctgcaaaaattgcgtaccgattatgttgatctgacgctaatccactggccgtca
ccaaacgatgaagtctctgttgaagagtttatgcaggcgctgctggaagccaaaaaacaa
gggctgacgcgtgagatcggtatttccaacttcacgatcccgttgatggaaaaagcgatt
gctgctgttggtgctgaaaacatcgctactaaccagattgaactctctccttatctgcaa
aaccgtaaagtggttgcctgggctaaacagcacggcatccatattacttcctatatgacg
ctggcgtatggtaaggccctgaaagatgaggttattgctcgtatcgcagctaaacacaat
gcgactccggcacaagtgattctggcgtgggctatgggggaaggttactcagtaattcct
tcttctactaaacgtaaaaacctggaaagtaatcttaaggcacaaaatttacagcttgat
gccgaagataaaaaagcgatcgccgcactggattgcaacgaccgcctggttagcccggaa
ggtctggctcctgaatgggattaa
              
                            

Download fasta file
RegulonDB