RegulonDB RegulonDB 10.9: Gene Sequence
yafC gene sequence


Size: 915        A: 243  T: 218  G: 244  C: 210

Fasta

 

>yafC E. coli K12. Version NC_000913.3 GI:556503834
atgaaagccacgtcggaagaactcgccatttttgtttcggtcgtcgaaagcggcagcttt
agccgggcagcggaacaattagggcaagcaaactcagcggtaagccgggcggtgaaaaag
ctggagatgaaacttggcgttagcctgcttaatcggaccacgcgacaacttagcctgacg
gaagaaggcgagcgttattttcgtcgcgtacagtcaattttgcaggagatggcagcggca
gaatcagaaattatggagacgcgtaatacaccgcgtggactgttacggatcgatgccgca
actccagtggtgctgcactttctgatgccgttaattaagcctttccgtgaacgctatccg
gaagtcactttgtcgctagtctcctccgaaacgattattaatttgatcgaaagaaaagtg
gatgtcgcgatacgcgctggtacgttaacggattccagcttacgtgccaggccgttattt
aacagttatcgaaaaattatcgcctcccccgattatatttcccgctacgggaagccagaa
acgatcgacgatttaaagcaacatatttgcctgggattcactgaacccgcttccctcaat
acctggccgatagcccgtagcgatggacaattacatgaggtgaagtacggtttgtcatcc
aatagtggggaaacactgaaacagctttgcctgagtggcaacgggattgcgtgtttgtcc
gactacatgatcgacaaagaaatcgctcgcggagaattggtggagttaatggcagataaa
gtgttgccagtggaaatgccattcagtgccgtctattacagcgaccgtgcggtaagtacg
cgcatccgggcttttatcgatttccttagcgagcatgtaaaaacagctcccggaggagct
gtcagagaggcttaa
              
                            

Download fasta file
RegulonDB