RegulonDB RegulonDB 10.10: Gene Sequence
yafE gene sequence


Size: 624        A: 165  T: 153  G: 165  C: 141

Fasta

 

>yafE E. coli K12. Version NC_000913.3 GI:556503834
atgtcaggtctgccacagggcagaccaacgtttggcgctgcgcaaaacgtgagcgcggtg
gtggcgtatgacttatctgcccacatgctggatgtcgtggcacaagctgccgaagcccgg
caactgaaaaatatcaccacccgccagggatatgccgaaagtctgccatttgccgataac
gcatttgatattgttatcagccgttattctgcccatcactggcatgatgttggtgcagca
ctgcgagaagtgaataggatattgaaacctggcggtaggctgattgtgatggacgtaatg
tctccgggtcacccagtgcgcgacatctggttacagacggtagaagcattacgcgatacc
tctcacgtacgaaactacgccagcggtgagtggttgacgttaatcaatgaagccaatctg
atagttgataatttaattacagataagttaccgctggaattttcttcatgggtcgcgaga
atgcgtacgccagaagcgttagtagacgctattcgcatttaccaacagagcgcatcgaca
gaggtgagaacgtattttgccttgcagaatgatggctttttcaccagtgatatcatcatg
gtagatgcacataaagcggcataa
              
                            

Download fasta file
RegulonDB