RegulonDB RegulonDB 10.9: Gene Sequence
fliG gene sequence


Size: 996        A: 241  T: 201  G: 290  C: 264

Fasta

 

>fliG E. coli K12. Version NC_000913.3 GI:556503834
atgagtaacctgacaggcaccgataaaagcgtcatcctgctgatgaccattggcgaagac
cgggcggcagaggtgttcaagcacctctcccagcgtgaagtacaaaccctgagcgctgca
atggcgaacgtcacgcagatctccaacaagcagctaaccgatgtgctggcggagtttgag
caagaagctgaacagtttgccgcactgaatatcaacgccaacgattatctgcgctcggta
ttggtcaaagctctgggtgaagaacgtgccgccagcctgctggaagatattctcgaaact
cgcgataccgccagcggtattgaaacgctcaactttatggagccacagagcgccgccgat
ctgattcgcgatgagcatccgcaaattatcgccaccattctggtgcatctgaagcgcgcc
caagccgccgatattctggcgttgttcgatgaacgtctgcgccacgacgtgatgttgcgt
atcgccacctttggcggcgtgcagccagccgcgctggcggagctgaccgaagtactgaat
ggcttgctcgacggtcagaatctcaagcgcagcaaaatgggcggcgtgagaacggcagcc
gaaattatcaacctgatgaaaactcagcaggaagaagccgttattaccgccgtgcgtgaa
ttcgacggcgagctggcgcagaaaatcatcgacgagatgttcctgttcgagaatctggtg
gatgtcgacgatcgcagcattcagcgtctgttgcaggaagtggattccgaatcgctgttg
atcgcgctgaaaggagccgagcagccactgcgcgagaaattcttgcgcaatatgtcgcag
cgtgccgccgatattctgcgcgacgatctcgccaaccgtggtccggtgcgtctgtcgcag
gtggaaaacgaacagaaagcgattctgctgattgtgcgccgccttgccgaaactggcgag
atggtaattggcagcggcgaggatacctatgtctga
              
                            

Download fasta file
RegulonDB