RegulonDB RegulonDB 10.9: Gene Sequence
fliH gene sequence


Size: 687        A: 166  T: 129  G: 205  C: 187

Fasta

 

>fliH E. coli K12. Version NC_000913.3 GI:556503834
atgtctgataatctgccgtggaaaacctggacgccggacgatctcgcgccaccacaggca
gagtttgtgcccatagtcgagccggaagaaaccatcattgaagaggctgaacccagcctt
gagcagcaactggcgcaactgcaaatgcaggcccatgagcaaggttatcaggcgggtatt
gccgaaggtcgccagcaaggtcataagcagggctatcaggaaggactggcccaggggctg
gagcaaggtctggcagaggcgaagtctcaacaagcgccaattcatgcccggatgcagcaa
ctggtcagcgaatttcaaactacccttgatgcacttgatagtgtgatagcgtcgcgcctg
atgcagatggcgctggaggcggcacgtcaggtcatcggtcagacgccaacggtggataac
tcggcactgatcaaacagatccaacagttgttgcagcaagaaccgttattcagcggtaaa
ccacagctgcgcgtgcacccggatgatctgcaacgtgtggatgatatgctcggcgctacc
ttaagtttgcatggctggcgcttgcggggcgatcccaccctccatcctggcggctgtaaa
gtctccgccgatgaaggcgatctcgacgccagtgtcgccactcgctggcaagaactctgc
cgtctggcagcaccaggagtggtgtaa
              
                            

Download fasta file
RegulonDB