RegulonDB RegulonDB 10.10: Gene Sequence
ybbA gene sequence


Size: 687        A: 152  T: 146  G: 213  C: 176

Fasta

 

>ybbA E. coli K12. Version NC_000913.3 GI:556503834
atgccagcggaaaacattgttgaagttcatcatcttaagaagtccgtcggtcagggggag
catgaactctccatcctcaccggagttgagctggttgtcaaacgtggcgagaccatcgca
ctggtgggcgagtcgggatcgggtaagtcaaccttgctggcgatcctcgccgggcttgat
gacggcagcagtggcgaagtgagtctggtgggacaaccgctacataatatggacgaagaa
gcgcgggcaaagttgcgcgcgaagcacgtcggctttgtttttcagtcatttatgttaatt
cctacccttaacgcgctggaaaacgtcgagcttccggctctgctgcgcggtgagagtagc
gcggaaagtcgtaacggggcgaaagcgttgctcgaacagttagggctgggtaaacgtctg
gatcatcttccggcacagctttccggcggtgaacagcaacgagtggcgctggcacgagcc
tttaatggtcgacctgatgtgctgtttgccgacgaacccaccggcaaccttgaccgccag
acgggcgataaaattgccgacctgctgttttccctcaaccgtgaacatggcaccacgttg
attatggtgacccacgacctgcaactggcggcacgctgcgaccgctgcttacggctggtg
aacgggcagttgcaggaggaagcatga
              
                            

Download fasta file
RegulonDB