RegulonDB RegulonDB 10.9: Gene Sequence
uidB gene sequence


Size: 1374        A: 276  T: 386  G: 377  C: 335

Fasta

 

>uidB E. coli K12. Version NC_000913.3 GI:556503834
atgaatcaacaactctcctggcgcaccatcgtcggctacagcctcggtgacgtcgccaat
aacttcgccttcgcaatgggggcgctcttcctgttgagttactacaccgacgtcgctggc
gtcggtgccgctgcggcgggcaccatgctgttactggtgcgggtattcgatgccttcgcc
gacgtctttgccggacgagtggtggacagtgtgaatacccgctggggaaaattccgcccg
tttttactcttcggtactgcgccgttaatgatcttcagcgtgctggtattctgggtgctg
accgactggagccatggtagcaaagtggtgtatgcatatttgacctacatgggcctcggg
ctttgctacagcctggtgaatattccttatggttcacttgctaccgcgatgacccaacaa
ccacaatcccgcgcccgtctgggcgcggctcgtgggattgccgcttcattgacctttgtc
tgcctggcatttctgataggaccgagcattaagaactccagcccggaagagatggtgtcg
gtataccatttctggacaattgtgctggcgattgccggaatggtgctttacttcatctgc
ttcaaatcgacgcgtgagaatgtggtacgtatcgttgcgcagccgtcattgaatatcagt
ctgcaaaccctgaaacggaatcgcccgctgtttatgttgtgcatcggtgcgctgtgtgtg
ctgatttcgacctttgcggtcagcgcctcgtcgttgttctacgtgcgctatgtgttaaat
gataccgggctgttcactgtgctggtactggtgcaaaacctggttggtactgtggcatcg
gcaccgctggtgccggggatggtcgcgaggatcggtaaaaagaataccttcctgattggc
gctttgctgggaacctgcggttatctgctgttcttctgggtttccgtctggtcactgccg
gtggcgttggttgcgttggccatcgcttcaattggtcagggcgttaccatgaccgtgatg
tgggcgctggaagctgataccgtagaatacggtgaatacctgaccggcgtgcgaattgaa
gggctcacctattcactattctcatttacccgtaaatgcggtcaggcaatcggaggttca
attcctgcctttattttggggttaagcggatatatcgccaatcaggtgcaaacgccggaa
gttattatgggcatccgcacatcaattgccttagtaccttgcggatttatgctactggca
ttcgttattatctggttttatccgctcacggataaaaaattcaaagaaatcgtggttgaa
attgataatcgtaaaaaagtgcagcagcaattaatcagcgatatcactaattaa
              
                            

Download fasta file
RegulonDB