RegulonDB RegulonDB 10.9: Gene Sequence
yedD gene sequence


Size: 414        A: 97  T: 81  G: 132  C: 104

Fasta

 

>yedD E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaactcgcaattgcaggcgcgctcttgttgctggcgggctgtgccgaagtcgaa
aactataacaatgtcgtgaaaacccccgcgccggactggctggcgggctactggcagacc
aaagggccgcaacgtgcgctggtcagcccggaagcgataggcagcctgattgtcactaaa
gagggcgataccctggattgccgtcagtggcagcgggtgattgccgtgccgggtaagttg
acattgatgtctgatgatctcactaacgttaccgtaaaacgtgagctgtacgaggttgag
cgtgacggtaacaccattgagtacgatggtatgacgatggagcgtgtggatcgcccgaca
gcagagtgtgccgccgcgctggataaagcgccgttaccgacgccactgccgtaa
              
                            

Download fasta file
RegulonDB