RegulonDB RegulonDB 10.9: Gene Sequence
yedF gene sequence


Size: 234        A: 64  T: 57  G: 60  C: 53

Fasta

 

>yedF E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaatatcgttcctgattaccgccttgatatggtgggtgaaccctgcccttatccg
gcagtcgcaacccttgaggcgatgccgcagttaaaaaaaggggaaatcctggaagtggtg
agcgactgtccgcagtcgatcaataatattccactggatgcgcgtaatcacggctatacg
gtgctggatattcagcaagacgggccgaccattcgttatttaattcagaagtaa
              
                            

Download fasta file
RegulonDB