RegulonDB RegulonDB 10.9: Gene Sequence
yedK gene sequence


Size: 669        A: 164  T: 158  G: 184  C: 163

Fasta

 

>yedK E. coli K12. Version NC_000913.3 GI:556503834
atgtgtggacgctttgcccaatcccaaacgcgtgaagattaccttgcgcttctcgcggaa
gatattgaacgcgatattccctatgatcccgaacccattggcagatacaacgtcgcgccg
ggaaccaaagtcctactgctcagtgaacgtgatgaacaccttcatctggatccggttttc
tggggatatgctcccggatggtgggataaaccgccgctgattaacgcccgcgtagaaact
gcggcaaccagtcgtatgtttaaaccgctctggcaacatggtcgggcaatctgttttgcc
gatggctggtttgagtggaaaaaagaaggcgacaaaaaacagcctttttttatctatcgt
gctgatggacaacctatttttatggccgcgataggtagcacaccatttgagcgtggtgac
gaagccgaaggatttttgatcgtcactgctgcggcagatcaaggtctggtagatattcat
gaccgccgcccactggtactgtcgccagaagctgcgcgggaatggatgcggcaagagatt
agcggtaaagaagcctcagaaatcgcggccagtggctgtgttccagcaaaccagttctcc
tggcacccggtatcgcgcgcggtgggtaatgttaaaaaccagggcgcggagttaattcaa
cctgtttga
              
                            

Download fasta file
RegulonDB