RegulonDB RegulonDB 10.9: Gene Sequence
atoS gene sequence


Size: 1827        A: 493  T: 447  G: 414  C: 473

Fasta

 

>atoS E. coli K12. Version NC_000913.3 GI:556503834
atgcattatatgaagtggatttatccacgccgcttacgcaatcaaatgatcctgatggca
atcctgatggtcattgtcccaacgcttactattggttatatcgtagaaacggaaggacgt
tcagcagtcttatctgaaaaagagaaaaaactttctgccgtggtcaacctgcttaatcag
gcactaggcgatcgctatgatctctacatcgacttaccacgtgaggagcgtatccgcgca
ttaaatgcagaacttgcccccattaccgaaaatatcactcacgccttccctggcatcggt
gctggttattacaacaaaatgctggatgcgataatcacctacgcgccttcagcgctatat
cagaataatgtcggcgttaccattgccgcagatcaccctggtcgcgaagtgatgcgtaca
aatacccctttagtttattcaggcaggcaggtgcgcggcgatattttgaattcaatgctc
cccattgagcgtaatggtgaaatcctcggctatatctgggccaatgaattaaccgaagat
attcgccgccaggcctggaaaatggatgtgaggattatcattgtgctcaccgctggtttg
ctgataagcctgctgttgattgtccttttctcccgtcgcctgagcgccaatattgatatc
atcaccgatggcctctcgactctggcacaaaatattcccactcgattaccacaattgccc
ggtgaaatggggcaaatcagtcagagtgttaataacctcgcccaggcactgcgtgaaacg
cggacacttaacgatctgattattgaaaacgctgccgatggcgtcattgccattgaccgc
cagggtgatgtaaccaccatgaacccagcagcagaagttatcactggctatcaacgccat
gaactggtagggcagccttactccatgttgttcgacaatactcagttctacagtccagta
ctggatacgctggaacatggcaccgaacatgtggcgctggagatcagttttccaggtcgt
gaccgcaccattgaactcagtgtcactaccagtcgtattcataacacgcacggtgaaatg
ataggtgctttggtgattttctctgatttaactgcccgcaaagaaacccagcgccgcatg
gcgcaagcagaacgcctcgccacactgggtgagctgatggctggcgtcgcgcatgaagta
cgtaatccgttaacggctattcgtggttatgtacagatcttgcgccaacaaaccagtgac
ccaatacatcaggaatatctgtccgtagtactcaaagaaatcgattcaattaacaaagtt
attcagcaattgctcgaattttcacgtccacgccacagtcaatggcaacaagtcagcctc
aatgcattggttgaagaaactctggtactggtacaaaccgccggcgtacaagcgcgggtc
gacttcataagcgaactggataatgaattaagcccgattaacgccgatcgtgaactgctc
aaacaggtactactgaatatcctgatcaatgccgtccaggctatcagcgcacgagggaaa
attcgcattcaaacctggcaatacagcgactcacaacaggccatttcgatagaggacaac
ggctgtggcattgatctctcgctgcaaaaaaagatcttcgatccctttttcaccaccaaa
gcctcaggaaccgggcttggtctggcgttaagtcaacgcatcattaatgcccatcagggt
gatattcgcgtcgccagtttgccgggctacggcgcaaccttcacgcttattttaccgatc
aacccgcagggaaatcagactgtatga
              
                            

Download fasta file
RegulonDB