RegulonDB RegulonDB 10.10: Gene Sequence
atoA gene sequence


Size: 651        A: 145  T: 157  G: 192  C: 157

Fasta

 

>atoA E. coli K12. Version NC_000913.3 GI:556503834
atggatgcgaaacaacgtattgcgcgccgtgtggcgcaagagcttcgtgatggtgacatc
gttaacttagggatcggtttacccacaatggtcgccaattatttaccggagggtattcat
atcactctgcaatcggaaaacggcttcctcggtttaggcccggtcacgacagcgcatcca
gatctggtgaacgctggcgggcaaccgtgcggtgttttacccggtgcagccatgtttgat
agcgccatgtcatttgcgctaatccgtggcggtcatattgatgcctgcgtgctcggcggt
ttgcaagtagacgaagaagcaaacctcgcgaactgggtagtgcctgggaaaatggtgccc
ggtatgggtggcgcgatggatctggtgaccgggtcgcgcaaagtgatcatcgccatggaa
cattgcgccaaagatggttcagcaaaaattttgcgccgctgcaccatgccactcactgcg
caacatgcggtgcatatgctggttactgaactggctgtctttcgttttattgacggcaaa
atgtggctcaccgaaattgccgacgggtgtgatttagccaccgtgcgtgccaaaacagaa
gctcggtttgaagtcgccgccgatctgaatacgcaacggggtgatttatga
              
                            

Download fasta file
RegulonDB