RegulonDB RegulonDB 11.0: Gene Sequence
atoB gene sequence


Size: 1185        A: 287  T: 270  G: 348  C: 280

Fasta

 

>atoB E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaattgtgtcatcgtcagtgcggtacgtactgctatcggtagttttaacggttca
ctcgcttccaccagcgccatcgacctgggggcgacagtaattaaagccgccattgaacgt
gcaaaaatcgattcacaacacgttgatgaagtgattatgggtaacgtgttacaagccggg
ctggggcaaaatccggcgcgtcaggcactgttaaaaagcgggctggcagaaacggtgtgc
ggattcacggtcaataaagtatgtggttcgggtcttaaaagtgtggcgcttgccgcccag
gccattcaggcaggtcaggcgcagagcattgtggcggggggtatggaaaatatgagttta
gccccctacttactcgatgcaaaagcacgctctggttatcgtcttggagacggacaggtt
tatgacgtaatcctgcgcgatggcctgatgtgcgccacccatggttatcatatggggatt
accgccgaaaacgtggctaaagagtacggaattacccgtgaaatgcaggatgaactggcg
ctacattcacagcgtaaagcggcagccgcaattgagtccggtgcttttacagccgaaatc
gtcccggtaaatgttgtcactcgaaagaaaaccttcgtcttcagtcaagacgaattcccg
aaagcgaattcaacggctgaagcgttaggtgcattgcgcccggccttcgataaagcagga
acagtcaccgctgggaacgcgtctggtattaacgacggtgctgccgctctggtgattatg
gaagaatctgcggcgctggcagcaggccttacccccctggctcgcattaaaagttatgcc
agcggtggcgtgccccccgcattgatgggtatggggccagtacctgccacgcaaaaagcg
ttacaactggcggggctgcaactggcggatattgatctcattgaggctaatgaagcattt
gctgcacagttccttgccgttgggaaaaacctgggctttgattctgagaaagtgaatgtc
aacggcggggccatcgcgctcgggcatcctatcggtgccagtggtgctcgtattctggtc
acactattacatgccatgcaggcacgcgataaaacgctggggctggcaacactgtgcatt
ggcggcggtcagggaattgcgatggtgattgaacggttgaattaa
              
                            

Download fasta file
RegulonDB