RegulonDB RegulonDB 10.9: Gene Sequence
panB gene sequence


Size: 795        A: 186  T: 175  G: 221  C: 213

Fasta

 

>panB E. coli K12. Version NC_000913.3 GI:556503834
atgaaaccgaccaccatctccttactgcagaagtacaaacaggaaaaaaaacgtttcgcg
accatcaccgcttatgactatagcttcgccaaactctttgctgatgaagggcttaacgtc
atgctggtgggcgattcgctgggcatgacggttcaggggcacgactccaccctgccagtt
accgttgccgatatcgcctaccacactgccgccgtacgtcgcggcgcaccaaactgcctg
ctgctggctgacctgccgtttatggcgtatgccacgccggaacaagccttcgaaaacgcc
gcaacggttatgcgtgccggtgctaacatggtcaaaattgaaggcggtgagtggctggta
gaaaccgtacaaatgctgaccgaacgtgccgttcctgtatgtggtcacttaggtttaaca
ccacagtcagtgaatattttcggtggctacaaagttcaggggcgcggcgatgaagcgggc
gatcaactgctcagcgatgcattagccttagaagctgctggggcacagctgctggtgctg
gaatgcgtgccggttgaactggcaaaacgtattaccgaagcactggcgatcccggttatt
ggcattggcgcaggcaacgtcactgacgggcagatcctcgtgatgcacgacgcctttggt
attaccggcggtcacattcctaaattcgctaaaaatttcctcgccgaaacgggcgacatc
cgcgcggctgtgcggcagtatatggctgaagtggagtccggcgtttatccgggcgaagaa
cacagtttccattaa
              
                            

Download fasta file
RegulonDB