RegulonDB RegulonDB 10.9: Gene Sequence
yadC gene sequence


Size: 1239        A: 385  T: 354  G: 229  C: 271

Fasta

 

>yadC E. coli K12. Version NC_000913.3 GI:556503834
atgaagactatcttcaggtacattctttttttagcactgtattcttgttgtaatacagtc
agtgcatatacaagttttattgtgggaaataatgcaggagttgataactatcgaggcccc
tccactgccgcacagatgacctttaattacacatcaacagcaagcaacttggttttttat
aaacccacgcagctcggcccgactggggtaaaaatgtactggtcatacctggatacaggt
accggtggtggtattctttactgcaatacatctggcagagcgaatcctggtccaataact
attgaaaatgccatggtctattcaggtaaagattatggcggacataaactatttaataca
tctgttcctggtctgtattacaccatgttaatatcaagggtctggtctgcatacgataca
ataactgacattcaatcgccaggaatctatatcggagatccttccaaccaagaatttttc
ttttccgtcacagacagcgatctacaaactaagggttgcaacaaagcagacgactacgat
aagttttgggctattggtggtatagtacacaacataactgttgaattttatacagatact
aatttcgatcctacacttaatcagcaagtccagttatccagttcatcaaattacctttat
tcgtttaaggcctacagtcctggtacaaaagttgtagatcacagcaaccacatttatgtc
aatttcacactgaataatgtcaaattaaccttaccaacatgttttacctccatacttacc
gggccatcagtcaatggttcaacggttagaatgggagaatatagctctgggacaattaaa
aatggcgcttcacctgttccctttgatatctcgcttcagaattgtattcgtgtgcgtaat
attgaaacaaaactcgtcactggaaaagtaggtactcaaaacacacaactgcttggtaat
acgcttactggaagcactgccgccaaaggcgttggcgtactcattgaaggtttagcaacc
agtaaaaatccgctaatgacattaaaacctaatgatacgaattctgtttatatagattat
gaaaccgaagatgacacctccgatggggtttaccctaatcaaggtaacggcacatcacag
cctcttcatttccaggcaacattaaagcaagacgggaatattgctatcgaacccggcgaa
tttaaagccaccagtactttccaggtaacctatccctga
              
                            

Download fasta file
RegulonDB