RegulonDB RegulonDB 10.9: Gene Sequence
lptB gene sequence


Size: 726        A: 170  T: 161  G: 200  C: 195

Fasta

 

>lptB E. coli K12. Version NC_000913.3 GI:556503834
atggcaacattaactgcaaagaaccttgcaaaagcctataaaggccgtcgcgtggtagaa
gacgtcagcctgaccgtcaactccggggaaattgtcggtctgctggggccaaacggtgcc
ggtaagaccaccactttctacatggttgtaggcattgtgccgcgcgatgcgggcaacatc
attattgatgatgacgatatcagtctgctgcctctgcatgcacgcgcgcgccgcggtatc
ggctatctgccacaggaagcctccattttccgtcgcctcagcgtttacgataacctgatg
gcggtactgcaaattcgtgacgacttgtctgctgaacaacgtgaagaccgcgcgaacgag
ctgatggaagagtttcacattgagcacctgcgtgacagcatggggcagtcactctccggg
ggtgaacgtcgccgtgtagaaattgcccgcgcactggctgcgaatccgaaatttattctg
ctcgacgaaccgtttgccggggttgacccgatctcggttatcgacattaaacgcatcatt
gagcacctgcgcgacagcggcctgggcgtgctgatcactgaccacaacgtgcgtgaaaca
ctggcggtttgtgaacgcgcttatatcgtcagtcaggggcatttgatcgcccacggcacg
cctacagaaatcttacaagacgaacacgttaagcgtgtataccttggggaagacttcaga
ctctga
              
                            

Download fasta file
RegulonDB