RegulonDB RegulonDB 10.9: Gene Sequence
hpf gene sequence


Size: 288        A: 96  T: 63  G: 63  C: 66

Fasta

 

>hpf E. coli K12. Version NC_000913.3 GI:556503834
atgcagctcaacattaccggaaataacgtcgagatcaccgaggcactgcgcgaatttgtt
acagccaaatttgccaaacttgagcaatattttgaccgaatcaaccaggtctatgttgtt
ctgaaagtggagaaagtcacccacacctcagatgcaacactgcatgtaaacggtggtgaa
attcatgccagcgcggaaggtcaggacatgtacgctgccattgatggcttaattgataag
ctggcacgccagttgaccaaacataaagataaactgaaacaacactaa
              
                            

Download fasta file
RegulonDB