RegulonDB RegulonDB 10.9: Gene Sequence
ptsN gene sequence


Size: 492        A: 131  T: 104  G: 127  C: 130

Fasta

 

>ptsN E. coli K12. Version NC_000913.3 GI:556503834
atgacaaataatgatacaactctacagcttagcagtgttcttaacagggaatgtacgcga
agccgcgtccactgtcagagcaaaaaacgcgccctggaaatcatcagcgagctggcggcg
aaacaacttagcctgccgcctcaggtggtttttgaagctatcctgacgcgggaaaaaatg
ggcagtaccggtatcggcaatggtattgccattccgcatggcaaactggaagaagatact
ctgcgcgccgttggcgttttcgttcagctcgaaacgcctatagctttcgatgccatcgac
aaccaaccggtggacttactttttgccctgctggtgccggcagaccaaactaaaacgcac
ctgcatactctgtcgctggtggcgaaacgtctggcggacaaaaccatctgccgccgttta
cgcgcagcccagagcgatgaagagctgtatcaaatcattacggataccgaaggtactccg
gatgaagcgtag
              
                            

Download fasta file
RegulonDB