RegulonDB RegulonDB 10.10: Gene Sequence
yicI gene sequence


Size: 2319        A: 537  T: 575  G: 656  C: 551

Fasta

 

>yicI E. coli K12. Version NC_000913.3 GI:556503834
atgaaaattagcgatggaaactggttgattcaacctggcctcaatttgattcacccgctt
caggtgttcgaggttgaacagcaggataatgaaatggtggtctatgctgccccccgtgat
gtgcgtgaacgtacctggcagcttgatacgcctttatttacgttgcgctttttctcccca
caggaaggtattgtcggtgtgcggattgagcattttcagggggcgctgaataacggtcct
cattatccgctcaatattttgcaggacgtgaaggtcacaatcgaaaacacagaacgttat
gctgagtttaaaagtggcaacttaagcgcgcgtgtcagcaaaggtgagttctggtcactg
gattttctgcgcaacggcgaacgtattaccggtagtcaggtgaaaaataatggctacgtg
caggacacgaataatcaacgcaattatatgtttgagcggcttgatcttggcgttggcgaa
acagtttacggtctgggagagcgctttactgccctggtgcgcaatggccagacggtagag
acctggaaccgggacggcggcacaagtactgaacaggcgtataaaaatatcccgttctac
atgactaaccgtggttatggggtactggtcaatcatccccagtgtgtctcttttgaagtg
ggatcggagaaagtctccaaagtgcagttcagcgttgagagtgaatatctcgaatacttt
gttatcgacggcccgacgccgaaagcggtacttgatcgttatacccgctttactggtcgt
ccggcgctgccgcccgcgtggtccttcggcctgtggctaaccacttcatttaccaccaac
tacgacgaagcgacggtaaacagctttatcgatggtatggcggaacgcaatctgccgctg
catgttttccactttgactgtttctggatgaaagccttccagtggtgcgattttgagtgg
gacccgctgactttccctgacccggaagggatgatccgccgcctgaaagcgaaaggactg
aaaatctgcgtctggattaacccctatatcggtcaaaaatcccccgtctttaaagagtta
caagagaaaggctatttactcaaacgcccggacggttcgctatggcagtgggataaatgg
cagccaggtctggcgatttatgactttaccaatccggatgcctgcaaatggtacgccgac
aaactgaaaggtctggtcgcgatgggcgttgattgctttaagaccgactttggcgaacgt
atcccaactgatgttcagtggtttgacggttccgatccgcagaaaatgcataaccattat
gcgtacatctacaacgaactggtgtggaacgtgctcaaggacaccgttggtgaggaagaa
gctgtcttgtttgcccgctcggcctccgtcggtgcgcagaaattcccggtacactggggt
ggcgattgttacgctaactacgaatcaatggcggaaagcctgcgcggtggtttgtctatt
ggcctttcaggttttggcttctggagccacgatatcggcggctttgaaaataccgctccg
gcgcacgtttacaaacgctggtgcgcgtttggtttgctctccagccatagccgtttacac
ggtagcaaatcttatcgtgtgccgtgggcctacgatgatgagtcctgtgatgtggtgcgc
ttcttcacgcaactgaaatgccgcatgatgccgtatctgtatcgtgaagctgcgcgtgcg
aacgcgcggggtacgccgatgatgcgggccatgatgatggagttcccggacgatccggct
tgtgattaccttgaccgtcaatacatgttaggcgacaacgtgatggttgcgccggtgttc
actgaagcgggcgatgtgcagttctacctgccggaaggtcgctggacacacctgtggcac
aacgatgaactcgacggtagtcgctggcataaacagcagcacggcttcctgagtctgccc
gtttatgtgcgtgataacactctactggcgctgggcaacaacgatcaacgtcccgattac
gtgtggcacgaaggcacggcattccacctcttcaatctgcaagacgggcatgaagccgtc
tgtgaagtgcccgctgctgacggatcggtgatctttactttaaaagcagcacgtactggc
aacacgattactgtgactggtgcgggcgaggcgaagaactggacactgtgcctgcgcaat
gttgtgaaagtaaatggtctgcaagacggttcgcaggctgaaagtgagcaggggctggtg
gtgaagcctcaagggaatgcgctgacaattacgttgtaa
              
                            

Download fasta file
RegulonDB