RegulonDB RegulonDB 10.9: Gene Sequence
yicJ gene sequence


Size: 1383        A: 300  T: 400  G: 356  C: 327

Fasta

 

>yicJ E. coli K12. Version NC_000913.3 GI:556503834
atgaagagtgaagtgttgtccgttaaagagaaaattggttatggcatgggagacgccgcc
agccacattattttcgataacgtaatgttatatatgatgttcttttataccgatattttt
ggcattcctgccggttttgtcggaaccatgtttttggtcgctcgtgcactggatgcgatt
tccgatccttgcatggggttgttggccgatcgaacgcgctctcgctggggtaaatttcgt
ccgtgggtactgtttggcgcactgccattcgggatcgtctgtgtactggcctatagcacg
ccagatctcagtatgaacggcaaaatgatctatgcagcaattacttacaccctacttacc
ttactttataccgtcgtcaatatcccttactgcgcattgggtggtgtaatcaccaatgac
ccgactcagcgtatctcgctgcaatcctggcgttttgtgctggcgaccgcgggaggcatg
ctttctactgttctgatgatgccactggttaatttaattggcggtgataataaaccactc
ggtttccagggcggtatcgcggtcctttccgtggtggcattcatgatgctggcattttgt
ttcttcaccactaaagaacgcgttgaagcaccacctacaacaacgtctatgcgggaagat
ttacgtgatatctggcaaaacgaccagtggcggattgtcggtttactaaccattttcaat
atcctggcggtgtgcgtacgcggtggggcgatgatgtattacgtcacatggattttgggc
acgccggaagtgtttgtcgcttttctcaccacttattgcgtgggtaacctgattggttcc
gcactggcaaaacctctgaccgactggaaatgtaaagtcactatcttctggtggacgaac
gccctgctggcagtgattagcctcgcgatgttctttgttcccatgcaggccagcatcact
atgtttgtcttcatcttcgtgattggtgtgttgcatcaactggtgacacctatccagtgg
gtaatgatgtccgataccgtcgactacggcgagtggtgcaatggtaaacgcctgaccggg
atcagttttgctggcacgctgtttgtgctcaaactggggttggccttcggcggcgctctt
atcggctggatgctggcttatggcggatatgatgcggcagaaaaagcgcagaacagcgcc
acgattagcatcattattgcgctattcacgattgttccggcgatctgttatttgctgagc
gcgattatcgctaaacgctactactcactcacgacgcacaatctgaaaaccgttatggaa
cagctggctcagggtaaacgccgttgccagcaacaattcacctctcaagaagtgcagaac
taa
              
                            

Download fasta file
RegulonDB