RegulonDB RegulonDB 10.9: Gene Sequence
galM gene sequence


Size: 1041        A: 229  T: 233  G: 290  C: 289

Fasta

 

>galM E. coli K12. Version NC_000913.3 GI:556503834
gtgctgaacgaaactcccgcactggcacccgatggtcagccgtaccgactgttaactttg
cgtaacaacgcagggatggtagtcacgctgatggactggggtgcgactttactttccgcc
cgtattccgctttccgatggcagcgtccgcgaggcgctgctcggctgtgccagcccggaa
tgctatcaggatcaggccgcgtttctgggggcctctattggtcgttatgccaaccgtatc
gccaatagccgttatacctttgacggtgaaaccgtgacgctttcgccaagtcagggcgtt
aaccagctgcacggcgggccggaagggttcgacaaacgtcgctggcagattgtgaaccag
aacgatcgtcaggtgctgtttgccctgagttcagatgatggtgatcagggcttcccgggt
aatctcggcgcgacggtgcaatatcgtctgaccgacgataaccgtatctccattacttat
cgcgccacagttgataaaccttgcccggtgaatatgactaatcacgtctatttcaatctt
gacggcgagcagtctgacgtgcgcaatcacaagttgcagattctggcggacgaatatctg
ccggttgatgaaggcggcattccgcacgacggcctgaaatctgtcgccggaacgtctttt
gatttccgcagcgccaaaatcatcgccagtgagtttcttgccgacgacgatcagcgcaaa
gtgaaaggttacgatcacgcattcttgttacaggccaaaggcgatggcaagaaagtggcg
gcgcatgtctggtcagcagatgaaaaattgcagctgaaggtctacaccaccgctccggct
ctgcaattctactccggcaacttcctcggcggcacaccgtcgcggggaaccgaaccttac
gccgactggcaagggctggctctggaaagcgagtttctaccggacagcccgaaccaccct
gaatggccgcaaccggactgcttcctgcgtcctggcgaagagtattccagcctgacggaa
tatcagtttattgctgagtaa
              
                            

Download fasta file
RegulonDB