RegulonDB RegulonDB 10.9: Gene Sequence
pnuC gene sequence


Size: 720        A: 150  T: 223  G: 196  C: 151

Fasta

 

>pnuC E. coli K12. Version NC_000913.3 GI:556503834
atggatttttttagtgtgcagaatatcctggtacatataccaataggggcaggcggttat
gatctctcatggatcgaagcggtaggcacgatcgccgggttgctgtgtattggccttgcc
agtctggagaagatcagcaactacttctttggcctgatcaacgtcaccttgtttggcatt
attttctttcagattcagctgtatgccagcctgctattacaggtgtttttctttgccgcg
aatatttacggttggtatgcgtggtcgcgacaaaccagtcagaacgaggcggagttgaaa
attcgctggttgccattgccgaaggcactcagctggttggcggtttgcgttgtttcgatt
ggtctgatgacggtatttatcaatccggtgtttgcatttttgacccgcgtggcagtcatg
atcatgcaagcattaggattacaggttgtgatgcctgaactgcaaccggacgctttcccg
ttctgggattcatgcatgatggtgttatctatcgtggcaatgattctgatgacgcgtaag
tatgtggaaaactggctgttgtgggtgattattaacgtgattagcgtcgttatttttgca
cttcagggcgtttacgccatgtctctggagtacatcatcctgacctttattgcgctcaac
ggcagccggatgtggatcaacagcgcacgtgaaagaggctcacgcgcgctgtcccattaa
              
                            

Download fasta file
RegulonDB