RegulonDB RegulonDB 10.9: Gene Sequence
udk gene sequence


Size: 642        A: 168  T: 161  G: 161  C: 152

Fasta

 

>udk E. coli K12. Version NC_000913.3 GI:556503834
atgactgatcagtctcatcagtgcgtcattatcggtatcgctggcgcatcggcttccggc
aagagtcttattgccagtaccctttatcgtgaattgcgtgagcaagtcggtgatgaacac
atcggcgtaattcccgaagactgctattacaaagatcaaagccatctgtcgatggaagaa
cgcgttaagaccaactacgaccatcccagcgcgatggatcacagtctgctgcttgagcat
ttacaagcgttgaaacgcggctcggcaattgacctgccggtttacagctatgttgaacat
acgcgtatgaaagaaacggtgacggttgagccgaagaaggtcatcattctcgaaggcatt
ttgttgctgacggatgcgcgtttgcgtgacgaacttaacttctccattttcgttgatacc
ccgctggatatctgcctgatgcgccgcatcaagcgtgacgttaacgagcgtgggcgttca
atggattcagtgatggcgcaatatcaaaaaaccgtgcgcccgatgttcctgcaattcatt
gagccttctaaacaatatgcggacattatcgtgccgcgcggcgggaaaaaccgcatcgcg
atcgatatattgaaagcgaaaataagtcagttctttgaataa
              
                            

Download fasta file
RegulonDB