RegulonDB RegulonDB 11.0: Gene Sequence
yidK gene sequence


Size: 1716        A: 343  T: 455  G: 479  C: 439

Fasta

 

>yidK E. coli K12. Version NC_000913.3 GI:556503834
atgaattcgttacaaatcttgagttttgtcggttttacgctgctggtggcggtgatcacc
tggtggaaggtccgcaaaacagataccggatcgcaacaaggctattttcttgccggacgt
tcactaaaagcgccggttattgccgcttcgttaatgctaaccaacctttccacggaacaa
ctggtcggcctttccgggcaggcctacaaaagcggcatgtcggtgatgggctgggaagtg
acttcagcggtgacgctgatcttcctcgcgctaatctttttaccgcgctatctgaagcgc
ggcattgccaccatccccgattttctggaggaacgttatgataaaacgacgcgtattatc
atcgacttctgcttcctaattgccaccggcgtctgctttctgccgattgttctctactcc
ggcgcgttggcgctcaacagcctgtttcacgtcggggaatcgctacagatttctcacggt
gcggctatctggctactggtaattttgcttggtctggcgggaattttgtatgcggtgatc
ggcggactgcgcgcaatggcagtggcggactccatcaacggtattgggctggttatcggc
gggttgatggtgccggtatttggcctaatcgcgatgggcaagggcagctttatgcagggc
attgagcaactcaccaccgttcacgccgagaaattaaactcaatcggtggcccgaccgat
cccttgccgattggcgcggcatttaccggtttgattctggtgaacaccttttactggtgt
acaaatcagggcatcgtgcaacgcacgctggcgtcaaaaagcctggcggaagggcaaaag
ggggcgctgttaacggcggtgctgaaaatgctcgacccgctggtactggtgctgccaggg
ttgattgcgtttcatctgtatcaggatttaccgaaagccgacatggcctacccgacgctg
gtcaataacgttctgccagtgccaatggtgggtttcttcggcgcggtgttatttggtgcg
gtgatcagtaccttcaacggctttctgaatagcgccagtacgttattcagtatgggtatt
taccgtcgcatcattaaccagaatgccgagccgcagcagctggtcaccgtcgggcgcaaa
tttggtttctttatcgctatcgtttcggtgctggtcgcgccgtggatcgccaacgcgccg
caggggctgtatagctggatgaaacagctcaacggcatttacaacgtgccgctggttacc
atcatcattatgggctttttcttcccgcgcatcccggcgctggcggcaaaagtagcgatg
gggattggcataatcagctacatcaccatcaactatctggtgaagttcgacttccatttc
ctctatgtgctggcctgtacgttctgcatcaacgtggtcgtgatgctggtgatcggtttt
atcaaaccgcgcgccacgccgttcaccttcaaagatgcgtttgcggtggacatgaaaccg
tggaaaaacgtcaagatcgcgtcaattggcatcctgttcgcgatgattggcgtctatgcc
gggctggctgaattcggcggctacggtacgcgctggttagcgatgatcagttatttcatt
gccgccgtagtgattgtctacctgatttttgacagctggcggcatcgtcacgacccagcc
gtaacctttactcccgacgggaaggatagcctatga
              
                            

Download fasta file
RegulonDB