RegulonDB RegulonDB 10.9: Gene Sequence
glvG gene sequence


Size: 639        A: 157  T: 142  G: 176  C: 164

Fasta

 

>glvG E. coli K12. Version NC_000913.3 GI:556503834
atgaccaaattctcagtggttgtcgcaggcggtggaagcacctttacgccaggcatcgtg
ttgatgctcctggcgaatcaggaccgtttcccgcttcgtgcactgaaattttatgataac
gatggtgcgcggcaggaagtgattgccgaagcctgtaaagtcatccttaaagaaaaagcg
ccggacattgcgtttagttacaccaccgatcctgaagtggcattcagcgacgttgatttt
gtcatggcgcacatccgcgtcggcaaatacccgatgcgcgaactggatgaaaaaatcccg
ctgcgccacggcgttgttggtcaggaaacttgcggacccggcggaatagcgtacggcatg
cgttccattggcggcgtcctggaactggtggattatatggaaaaatattcaccaaatgcc
tggatgctcaactactccaacccggcagccattgtcgcagaagccacgcgtcgtctgcgc
ccgaatgcgaaaatcctcaacatctgtgacatgccaatcggtattgaaagccggatggcg
caaattgttgggctgcaagatcgcaaacagatgcgcgtgcgctactacggcctgaaccac
tggtggtcggcgatatcccgcagtttcagaaagggttaa
              
                            

Download fasta file
RegulonDB