RegulonDB RegulonDB 10.9: Gene Sequence
glvB gene sequence


Size: 486        A: 128  T: 112  G: 124  C: 122

Fasta

 

>glvB E. coli K12. Version NC_000913.3 GI:556503834
atgttcagcaaccacgcggatatgatgctgacccaaatcgccattgggttgtgctttacc
ctgctgtacttcgtggttttccgcacactgattctgcagttcaacatgtgcacgccggga
cgtgaagatgcggaagtgaaactctactcaaaagccgaatacaaagcctcgcgaggccaa
accaccgcggcagagccaaaaaaagagctggatcaggctgccggtatcctgcaagccctg
ggcggggtcggcaatatctccagcattaacaattgcgcgacgcgtttacgtattgcactg
catgacatgtcacaaacgctggatgacgaagtctttaaaaagctgggagcgcacggcgtc
ttccgtagtggcgatgccattcaggtgatcattggtctgcatgtatctcagctgcgtgaa
cagctcgatagcttaattaattctcatcaatcagcagaaaatgttgccattacggaggca
gtataa
              
                            

Download fasta file
RegulonDB