RegulonDB RegulonDB 10.10: Gene Sequence
glvC gene sequence


Size: 1107        A: 213  T: 309  G: 312  C: 273

Fasta

 

>glvC E. coli K12. Version NC_000913.3 GI:556503834
atgctcagtcaaattcaacgctttggcggcgcgatgttcacgccagtgctgctgtttccc
ttcgccgggattgtggtgggtcttgccatcttgctgcaaaacccgatgtttgtcggggaa
tcactgaccgatccgaacagtttattcgcgcaaatcgtacacattattgaagagggcggt
tggacggtattccgtaatatgccgctgatttttgctgtcggtttacccattggccttgct
aagcaagcgcaggggcgtgcttgtctggcggtgatggtgagtttcctgacctggaactat
ttcatcaacgcgatgggaatgacctggggaagctacttcggcgtcgatttcactcaggac
gcggtggcaggtagcggtctgacaatgatggccgggattaaaaccctcgataccagcatt
atcggcgcaattatcatttccggcattgtgacggcgctgcataaccgtctgttcgataaa
aaactgccggtttttctcggcattttccaggggacgtcttatgtggtgattatcgccttc
ctggtgatgatcccctgtgcctggctgacgttgctcggctggccaaaagtacaaatgggg
attgaatctctgcaagcgttcctgcgttcggcgggtgcacttggggtctgggtttacacc
ttcctcgaacgtattctgatcccaaccggtttacaccacttcatctacggacagtttatc
tttggtccggcagctgttgaaggcggcattcagatgtactgggcgcagcatctgcaagag
ttcagtttgagcgccgagccgctgaaatcgttgttcccggaaggcggttttgccctgcac
ggtaactcaaaaatctttggtgccgtgggcatttctttagcgatgtacttcactgccgca
ccggaaaatcgggtaaaagtggcgggcttgctgattcccgcaaccttaaccgccatgctg
gtgggaattaccgaaccgctggaatttaccttcctgttcatttcaccgttgctgtttgcg
gtacacgccgtgctggcggcctcaatgtcgaccgtaatgtatctctttggtgtggtgggc
aacatgggcggaggtctgattgactag
              
                            

Download fasta file
RegulonDB