RegulonDB RegulonDB 10.10: Gene Sequence
yidP gene sequence


Size: 717        A: 184  T: 165  G: 202  C: 166

Fasta

 

>yidP E. coli K12. Version NC_000913.3 GI:556503834
atgatctacaaaagcattgcggagcggttaagaattcgacttaactccgcagatttcacg
ctaaacagccttcttcccggtgaaaaaaagctggcggaagagtttgcggtatcgcggatg
accatccgtaaagccattgacctgctggtagcgtgggggctggtggtccgccgccacggt
agtggcacttacctggtgcgcaaagatgtactgcatcaaaccgccagtctgaccgggctg
gtggaggtgttaaaacggcagggaaaaacggtcaccagccaggtgctgatttttgaaatc
atgcctgcgcctccggccattgccagccagttacggattcaaatcaacgagcagatctac
ttctcccgtcgcgttcgttttgtggaagggaaaccgctgatgctggaagacagctatatg
ccggtaaaactgttccgtaatctttcgctgcaacatctggaagggtcgaagtttgaatat
attgaacaagagtgcgggattttgattggcggtaattatgaaagcctgacgccagtgctc
gccgatagactgctggcgcggcaaatgaaggtagcggaacacacgccactgctgcggatc
acctcgttgtcatatagcgagagcggggagtttttgaattattcagtgatgttcagaaat
gccagcgaataccaggtggagtaccatttacggcgactccacccggaaaagagttaa
              
                            

Download fasta file
RegulonDB