RegulonDB RegulonDB 11.0: Gene Sequence
ravA gene sequence


Size: 1497        A: 383  T: 370  G: 382  C: 362

Fasta

 

>ravA E. coli K12. Version NC_000913.3 GI:556503834
atggctcaccctcatttattagcggaaagaatttcccgcctgagcagttcgttggaaaag
gggctttatgaacgtagccacgccatccgcttgtgtttattagcggcattaagtggtgaa
agtgtgttcctccttggcccgccaggtattgccaaaagtttgatcgcccggcgcttaaaa
ttcgcctttcagaatgcccgcgcgtttgaatatctgatgacccgcttctccacgccggaa
gaagtttttggtcccctttctattcaggcgctaaaagatgaagggcgctatgaacgttta
accagcggttacctgccggaagcagaaattgtctttctggatgagatctggaaagcgggc
ccggcaattcttaataccttgctcaccgccattaacgagcgccagttccgcaacggtgca
cacgtagaaaaaatcccgatgcgtctgctggtggcggcctccaacgagctgccggaagca
gacagcagtctggaagcgttatatgaccgcatgctgattcgtctgtggttagataaagtg
caggataaagcgaatttccgctccatgctgaccagtcaacaggatgaaaacgacaatccg
gttcctgatgccttgcaggtcacagatgaagaatatgaacgctggcagaaagagattggt
gaaattacgctgcccgatcatgtatttgagctgatttttatgctgcgccagcaactggat
aaattaccggatgcgccttatgtctcggatcgtcgctggaaaaaagcgatccgattattg
caggccagcgccttttttagcggtcgcagtgctgttgccccggtagatctcattttgctg
aaagattgcctgtggtatgacgcgcaaagcctgaatttgatacaacaacaaattgatgta
ttgatgaccggtcacgcctggcaacagcaagggatgttgactcgccttggcgcgattgtg
caacgtcacctgcaactccagcagcaacaaagcgataaaacagccttaacggtaattcgt
ctgggcggcattttcagccgtcgtcagcagtatcaacttcctgttaacgttactgcttcc
actctgactctactgctgcaaaaaccgttaaaactgcatgatatggaagtggttcatatc
tcctttgagcgtagcgcgctggaacagtggctgagcaaaggtggtgaaattcgcggtaaa
ctgaacggtatcggctttgcccagaaactgaatctggaagttgatagcgcccaacatctt
gtcgttcgcgatgtaagtttacaaggcagtacgctggcacttcccggttcatcggctgaa
ggtctgcctggtgaaataaaacaacaactggaagagcttgaaagcgactggcgcaagcaa
cacgctttattcagcgaacagcaaaaatgtctgtttatccctggcgactggttaggtcgc
attgaagccagcctacaggatgtcggtgcacagattcgccaggcacaacaatgctaa
              
                            

Download fasta file
RegulonDB