RegulonDB RegulonDB 10.9: Gene Sequence
metI gene sequence


Size: 654        A: 113  T: 199  G: 190  C: 152

Fasta

 

>metI E. coli K12. Version NC_000913.3 GI:556503834
atgtctgagccgatgatgtggctgctggttcgtggcgtatgggaaacgctggcaatgacc
ttcgtatccggtttttttggctttgtgattggtctgccggttggcgttctgctttatgtc
acgcgtccggggcaaattattgctaacgcgaagctgtatcgtaccgtttctgcgattgtg
aacattttccgttccatcccgttcattatcttgcttgtatggatgattccgtttacccgc
gttattgtcggtacatcgattggtttgcaggcagcgattgttccgttaaccgttggtgca
gcaccgtttattgcccgtatggtcgagaacgctctgctggagatcccaaccgggttaatt
gaagcttcccgcgcaatgggtgccacgccgatgcagatcgtccgtaaggtgctgttaccg
gaagcgctgccgggtctggtgaatgcggcaactatcaccctgattaccctggtcggttat
tccgcgatgggtggtgcagtcggtgccggtggtttaggtcagattggctatcagtatggc
tacatcggctataacgcgacggtgatgaatacggtactggtattgctggtcattctggtt
tatttaattcagttcgcaggcgaccgcatcgtccgggctgtcactcgcaagtaa
              
                            

Download fasta file
RegulonDB