RegulonDB RegulonDB 10.9: Gene Sequence
nfrA gene sequence


Size: 2973        A: 720  T: 616  G: 818  C: 819

Fasta

 

>nfrA E. coli K12. Version NC_000913.3 GI:556503834
atgaaggagaataaccttaatcgcgtcatcggatggtctggtttactgctgacgtcttta
ttgagtaccagcgcactcgcagacaatatcggcaccagcgcagaagagctggggctgagc
gattatcgccattttgttatttatccccgtctcgataaagcgctgaaggcacagaaaaat
aacgacgaagcaaccgccatccgcgaatttgaatatatacaccagcaggtgccggataat
attccgctgactttataccttgcggaagcctatcgccattttggtcatgatgaccgggcg
cggctgttgcttgaggatcaactgaaacgtcacccaggagatgcccgacttgagcgcagt
ctggcggctattccggttgaagtgaaaagcgttacgacagttgaagaactgcttgcccag
caaaaagcgtgcgatgctgcgccgaccctgcgttgtcgcagtgaagtcgggcagaatgcc
ctgcggctggcacagttacctgtcgccagagcgcaactgaacgatgcgacgtttgctgca
tcgccggaaggaaaaacgctgcgaaccgatctgctgcaacgggcaatctacctgaaacaa
tggtcccaggcagatacgctatacaatgaagcacgccagcagaacacattaagcgcggca
gaacgccgtcagtggtttgacgtgcttcttgccgggcagctggacgatcggatcctggca
ctgcaatcacaggggatcttcaccgatcctcagtcatatattacttacgcgaccgcgctg
gcttatcgtggcgaaaaagcacgcctccagcattatctcattgaaaataagccactattt
accacggacgcacaagagaaaagttggctctatctgttatctaaatacagcgctaacccc
gttcaggcgttggcgaattatacggtacagtttgccgacaaccgccagtatgttgttggc
gcgacgctaccggtgctgttaaaagaaggtcagtacgacgcagcgcaaaaactgctcgcc
accctccccgccaatgaaatgcttgaggagcgttatgctgtcagcgtggcgacccgtaac
aaggctgaagctctgcgtctggcacgattgctgtatcagcaagaaccggcaaatcttacc
cgcctggatcaactaacctggcaactgatgcagaacgagcagtcacgcgaagctgccgat
ttattgctgcaacgctatcctttccagggcgatgcgcgtgtcagccagactttaatggcg
cgactggcgtctctgctggaaagtcatccttacctggcaacgccggcgaaggtggcgatt
ttatcgaaacccttaccgctggcggagcaacgtcagtggcaaagtcagttgccgggtatt
gcagataattgcccggcaatagttcgcttgctgggcgatatgtcgccttcctacgatgcc
gccgcctggaaccgtctggcaaagtgttatcgggacacgctacccggtgtggcgttgtat
gcatggcttcaggccgaacaacgacaaccgagcgcctggcaacatcgtgcggtagcctat
caggcgtatcaggttgaggactacgccaccgcactggcggcctggcagaaaatcagtctt
cacgacatgagcaatgaggatctgcttgctgctgccaataccgcccaggcggcaggaaat
ggtgcggctcgcgatcgctggctacaacaggcagaaaaacgtggactgggaagcaatgcc
ctctactggtggctgcatgcgcaacgttacattcctggtcagccggaactcgcactgaac
gatctcacgcgctcaatcaatattgcgccttctgccaacgcttacgttgcgcgggcgaca
atttatcgccaacgtcataatgtcccggccgcggtgagtgatttgcgcgccgcgctggaa
ctggaaccgaataatagcaacacccaggcagcgcttggttacgccttgtgggatagcggt
gatatcgcacagtcgcgggaaatgctcgaaccggcgcataaagggcttccggacgatccg
gcactgatccgacaactggcctacgtgaaccagcgtctggatgacatgcctgcgacgcag
cactacgcccggctggtgattgatgacattgataatcaggcgctgataaccccactgacc
ccagaacaaaatcaacaacgcttcaatttccgccgtttgcatgaggaggtcggtcgccgc
tggacgttcagtttcgattcttccatcggcttgcgttccggcgcaatgagtaccgctaac
aataatgtcggcggcgcagcgccagggaaaagctatcgtagctacggacaactggaagcc
gagtaccgcatcggacgcaatatgctgctggaaggcgacctgctctcagtttatagccgc
gtctttgccgataccggagaaaacggggtgatgatgccggtgaaaaatccgatgtccggc
accggtctgcgctggaagccgctgcgcgatcagatctttttcatcgccgtcgaacagcag
ttgccgctgaacggccaaaatggcgcatccgataccatgctgcgcgccagcgcctcattc
tttaatggcggcaaatacagcgacgaatggcacccgaacggttcaggctggtttgcccaa
aacctgtacctcgatgcggcgcaatatatccgccaggatattcaggcgtggacggcagat
tatcgcgtcagctggcatcagaaggtagctaacggacagactattgagccttacgctcac
gttcaggacaacggctatcgtgataaaggcactcagggcgcgcagcttggcggagtcggg
gtccgctggaatatctggaccggcgagacgcactacgacgcctggccgcacaaagtcagt
ctcggcgtcgagtatcaacatacctttaaggcgattaatcaacgtaacggagagcgcaac
aacgcgtttctcaccattggagtgcactggtaa
              
                            

Download fasta file
RegulonDB