RegulonDB RegulonDB 10.10: Gene Sequence
yddA gene sequence


Size: 1686        A: 464  T: 486  G: 370  C: 366

Fasta

 

>yddA E. coli K12. Version NC_000913.3 GI:556503834
atgataaccattcccattacgcttcgtatgttgatagcaaagtatctctgtctgttgaag
cccttttggctgcgtaagaataataaaacttcagtgttgttaatcattattatcctcgcc
atgatccttggcgtggttaaaattcaggtctggttaaacgactggaataatgattttttc
aatgcgctaagccagaaagaaaccgataagctttggcagcttgtcctttggttccctgcc
ctgctggggatctttgtattaatatccgtaaacaaaacatggttaattaaactactgact
attcgctggcgcgaatggttaacagattactaccttaatcggtggtttgcagataaaaac
tactacttcacgcagatctacggcgagcataaaaatacagataaccctgaccaacgtatc
gctgaagacattctcttactgatcagcaaaacgctcagtctttcatttggcttcatccag
tcacttagcatgctgatcacctttaccgttattctttgggaaagcgcgggtacgctctca
ttcactgttggtggaacagaatggaatatccaggggtatatggtctataccgtcgtgctc
attgtgatcggtggaactttatttacccataaggtgggtaaacgtattcgtccgcttaat
gtggaaaaacaacgtagcgaagcgacatttcgaacaaatcttgtgcagcataataagcag
gcagaactgattgcgctaagcaatgctgagtctctacaacgccaggagttgagcgacaat
tttcataccattaaagagaactggcatcgtttaatgaatcgtcagcggtggcttgattac
tggcagaatatttattcgcgctcgcttagcgttcttccctactttctgttattgccgcag
tttattagcgggcagatcaatctgggcggactgatgaaatcgcgccaggcatttatgctg
gtatcgaacaatttaagctggtttatttataaatatgacgaacttgctgaactggctgcg
gttatcgatcgcttgtatgagttccatcaactcactgaacagcgccctacgaataagcct
aaaaattgccaacatgcggtacaagtggctgatgcgagtattcgtacgcctgataataag
atcatattagagaacctgaactttcatgtttcgccaggcaaatggctattactgaaaggc
tactctggcgcgggaaaaaccacactgcttaaaacattatcccactgctggccgtggttt
aaaggtgatatttcttctcctgctgacagttggtatgtgtcacaaacaccgttaatcaaa
accggcttactgaaagagattatttgtaaagcacttcccctgcccgtagacgataaatcg
ttgagcgaagtactgcatcaggttggtcttgggaaattggctgcgcgtattcatgaccac
gatcgctggggagatattctttccagcggcgaaaaacaacgtatcgccctggcacgatta
attttacgacgtccgaaatggatatttcttgacgaaactacctctcatcttgaggaacaa
gaggctatccgcttactgcgtttagtgcgtgaaaaactacccacaagcggcgtcattatg
gttacacatcaacccggtgtctggaacctggccgatgatatttgtgacattagcgcggtt
ttataa
              
                            

Download fasta file
RegulonDB