RegulonDB RegulonDB 10.10: Gene Sequence
yddB gene sequence


Size: 2373        A: 677  T: 605  G: 544  C: 547

Fasta

 

>yddB E. coli K12. Version NC_000913.3 GI:556503834
atgaagcgagttcttattcctggcgtcattttatgtggcgctgatgtggcgcaggccgtc
gatgacaaaaacatgtacatgcatttttttgaagagatgacggtctatgctcctgtccct
gtacccgtaaacggcaacacgcattacaccagtgaaagcatcgagcgtttaccgaccggg
aatggcaatatcagcgatctgctgagaaccaaccctgcggtacgcatggattcaacgcaa
agtacctcgttgaaccagggagatattcgccctgagaaaatctctattcacggtgcgtcg
ccctaccagaatgcctatttgattgacggtattagtgcaactaataacctgaacccagcg
aatgagtccgatgccagtagtgcaaccaatattagcgggatgtcacaggggtattatctt
gatgtcagcttactggacaatgtgacgctttatgacagttttgtgccggttgaatttggt
cgcttcaatggcggggtaattgatgcaaagatcaaacgcttcaacgctgatgatagcaag
gtgaaattgggttatcgcactacgcgttcggactggttaacatcgcatatcgatgagaat
aacaagagcgcatttaatcaaggctcttcaggaagtacttattactccccagattttaaa
aagaacttttataccttgtcgtttaatcaggaactcgctgataacttcggcgttaccgcc
ggtttatcgcgccgccagtctgatatcacccgcgcggattatgtttcgaatgacggcatt
gtcgccggtcgggcacagtataaaaacgttatcgatactgcattaagcaaatttacctgg
tttgccagcgaccgctttacccacgatttaaccttaaaatataccggctccagccgtgat
tataataccagcaccttcccgcagtctgatcgcgaaatgggtaataaatcctatggtctg
gcatgggatatggatacgcagctcgcatgggccaaactgcgtaccaccgttggttgggat
catattagtgattatacccgtcacgatcatgacatctggtacaccgaactttcatgtaca
tatggtgatattacagggcgttgcacccgtggcggattaggacacatttcccaggctgta
gataattacaccttcaaaacacgcctggactggcaaaaattcgccgtgggtaatgtttcg
catcaaccctacttcggcgcggaatacatctattccgatgcgtggactgaacgccataac
cagtctgaatcctatgtgattaatgctgccggaaagaaaactaaccataccatttaccat
aaaggtaaaggccgcctgggaattgacaactacacgctgtatatggcggatcgcattagc
tggcgtaatgtgtcattaatgcccggcgtgcggtatgactatgacaactatctgtcaaac
cacaatatctccccgcgctttatgacggaatgggatatttttgctaatcaaacctcaatg
attacagcaggttataaccgttactatggcgggaatattcttgatatgggattacgtgat
atccgcaatagctggacggaatcggtatcaggtaataaaactctgacgcgttatcaggat
ttgaaaacgccttataacgatgaactggcaatgggattgcagcagaaaatcggtaagaac
gttattgcgcgtgcaaactatgtttaccgtgaagcgcatgatcaaatcagcaaaagcagt
cgtaccgacagcgcgactaaaaccaccattactgaatataacaacgatggcaaaaccaaa
acgcattcgttcagcctcagttttgaactggccgaacccctgcatatccgccaggtagat
attaacccacaaattgtctttagctatatcaagagcaagggcaacttgtcgttaaacaat
ggttatgaggagagcaataccggtgataaccaggtggtttataacggtaatctggtctct
tacgatagcgttccagtggcagattttaataacccattaaagatctccttaaacatggat
ttcacgcatcaaccgagcgggttagtgtgggcgaatacgctggcctggcaagaagcgcgt
aaagctcgcattatccttggtaagacaaatgcgcaatacatcagcgaatattcagattac
aagcagtatgttgacgaaaaactggatagcagcctgacctgggacacccgcttgtcctgg
acgccacaatttctgcaacaacaaaacctgacgatcagtgccgatattctcaatgtactg
gatagcaaaaccgctgttgatacaacgaacaccggtgtggcgacctacgccagtggccgt
actttctggcttgatgtcagcatgaaattttaa
              
                            

Download fasta file
RegulonDB