RegulonDB RegulonDB 10.10: Gene Sequence
pqqL gene sequence


Size: 2796        A: 822  T: 670  G: 667  C: 637

Fasta

 

>pqqL E. coli K12. Version NC_000913.3 GI:556503834
atggagataattatgagaaacctctgtttcttactgacgttagtggcaactctgttgctc
cccgggcggctgattgccgccgccttaccgcaggatgaaaagttaattaccgggcaactg
gacaatggcttgcgatatatgatttatccgcatgctcatccaaaggatcaggtaaattta
tggctgcaaattcataccggttcattgcaggaagaagacaatgagctcggcgtggctcat
tttgtagaacatatgatgtttaacggcacaaaaacatggccgggtaataaagtcatcgaa
acatttgagtcaatgggcctgcgttttggtcgcgatgttaatgcctataccagctatgac
gaaacggtgtatcaggtgagtttgccgactacgcagaaacaaaatctgcaacaagtgatg
gcaatcttcagtgaatggagtaatgccgcaacctttgaaaaactcgaagtagacgctgaa
cgtggcgtaattactgaggaatggcgtgcccatcaggatgcgaaatggcgcacctctcag
gcgcgccgccctttcctgctggcaaatacccgtaatttagaccgtgaacctatcggcctg
atggatactgtcgccacggtcacaccggcacaattgcgccaattttatcaacgctggtat
caaccaaataatatgacctttatcgtggtcggcgatatcgacagtaaagaagcgctggcg
ctgataaaggataatttaagtaagcttccggctaacaaagcagctgaaaatcgcgtctgg
ccgacaaaagccgaaaaccacctgcgctttaatatcattaatgataaagaaaaccgggtg
aacggcatcgcactctattatcgcctgccaatggtacaagtgaacgatgagcaaagcttt
atcgaacaagctgaatggagcatgttagttcagctgttcaatcaacgtctgcaggaacgc
atacagtcgggcgagttgaagactatttctggcggcactgcgcgcagcgttaaaattgca
cccgattatcagtcgctgtttttccgtgtaaatgcacgagacgataatatgcaggatgct
gcgaatgcattaatggcagagttggcaaccattgatcagcatggtttttctgctgaagaa
ctcgatgatgtcaaatctacccgcctcacctggctgaaaaatgcggttgatcagcaagct
gaacgtgatttacgtatgctgaccagtcgcctggcatccagctcattaaataatacgccg
ttcttgtcgccggaagagacatatcaactttcgaaacgtctgtggcagcaaattaccgtg
caaagtctggcggaaaaatggcagcagttaagaaagaaccaggacgcattttgggagcaa
atggtaaacaatgaggttgccgccaaaaaagcattgtctcctgcggctatcctggcgctg
gaaaaggagtacgccaacaaaaagctggcggcttacgtcttcccaggcagaaatttatcg
ttaacagtagacgcagacccacaggcggaaattagcagcaaagaaacgctggcggagaat
ctgacatcattaacactttccaatggtgccagggttattctggcaaaatccgcgggtgaa
gagcaaaagctacaaattattgccgtatcgaataaaggcgatttaagtttccctgcgcag
caaaaatcacttatcgcgctggcaaataaagcagttagcggaagcggcgttggcgaactc
tcctcttccagcctgaaacgctggagtgcggaaaattcggtaaccatgagcagtaaagtc
agtggcatgaatacgttgctctccgttagcgcgcggactaataaccctgaacctggtttt
cagttgattaaccagcgaatcacccacagcacgattaacgataatatttgggcatcgcta
caaaatgctcaaattcaggcgttgaaaacgctcgaccagcgtccagcggagaaattcgcc
cagcagatgtatgagacgcgctatgctgatgaccgcacgaaattactgcaagaaaatcag
attgcacagtttactgccgcagatgcgctggctgccgatcgccaattgttttcatctcca
gcggatatcacgtttgtcattgtcggtaatgtcgcagaagacaaactcgtggcgttaatt
acgcgttacttaggatcaatcaaacactctgattcgccattagccgcaggtaaaccatta
actcgcgcgacggacaacgcatcggttactgtaaaagaacaaaatgaacctgtggcacag
gtttcacagtggaagcgttatgattcccggacacctgttaatctgccgacgcgtatggcg
ctcgatgcttttaacgtcgcactggcaaaagatctacgtgttaatattcgtgaacaggca
tctggagcatacagcgtttcttctcgcctctcggttgatcctcaggccaaagatatcagt
catttgctggcttttacttgtcaaccagaacgacatgatgaactgttaacgttagcgaat
gaagtgatggttaagcgtctggctaaagggatcagtgagcaagaactgaatgaataccag
caaaacgttcagcgcagcctcgatatccaacagcgtagcgttcaacaattagcgaacact
attgtaaatagtcttattcaatatgacgatcctgcagcatggactgagcaggagcaattg
ttgaaacaaatgacggtagagaatgttaacactgccgttaaacaatatctttctcatccg
gtaaatacttataccggagtattattgccaaaataa
              
                            

Download fasta file
RegulonDB