RegulonDB RegulonDB 10.9: Gene Sequence
panD gene sequence


Size: 381        A: 93  T: 88  G: 98  C: 102

Fasta

 

>panD E. coli K12. Version NC_000913.3 GI:556503834
atgattcgcacgatgctgcagggcaaactccaccgcgtgaaagtgactcatgcggacctg
cactatgaaggttcttgcgccattgaccaggattttcttgacgcagccggtattctcgaa
aacgaagccattgatatctggaatgtcaccaacggcaagcgtttctccacttatgccatc
gcggcagaacgcggttcgagaattatttctgttaacggtgcggcggcccactgcgccagt
gtcggcgatattgtcatcatcgccagcttcgttaccatgccagatgaagaagctcgcacc
tggcgacccaacgtcgcctattttgaaggcgacaatgaaatgaaacgtaccgcgaaagcg
attccggtacaggttgcttga
              
                            

Download fasta file
RegulonDB